View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_high_44 (Length: 208)
Name: NF1789_high_44
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 88 - 199
Target Start/End: Original strand, 12804935 - 12805046
Alignment:
| Q |
88 |
gactggctgtcatttattgattcgacaatgaaggatgacttagttgactcaccaataaggttgtgggttcaactcccgctataaatgtgaggatctcttt |
187 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| | |||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804935 |
gactcgctgtcatttattaattcgacaatgaaagttgacttagttgactcaccaacaagatcgtgggttcaactcccgctataaatgtgaggatctcttt |
12805034 |
T |
 |
| Q |
188 |
ggtggatgatgt |
199 |
Q |
| |
|
||||||||||| |
|
|
| T |
12805035 |
agtggatgatgt |
12805046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 12804828 - 12804889
Alignment:
| Q |
1 |
taaaatacatgttagatcaggagaaaaagagagatattaaggtgatttataatcacaagagttt |
64 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12804828 |
taaaatacatgttagatcaggagaaa--gagagatattaaggtgattcataatcacaagagttt |
12804889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 196
Target Start/End: Complemental strand, 36671728 - 36671661
Alignment:
| Q |
129 |
agttgactcaccaataaggttgtgggttcaactcccgctataaatgtgaggatctctttggtggatga |
196 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||| | |||||||| | ||||||| ||||||| |
|
|
| T |
36671728 |
agttgactcacccacaaggtagtgggttcaactcccgctgtcaatgtgagaacctctttgatggatga |
36671661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University