View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_low_12 (Length: 320)
Name: NF1789_low_12
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 292
Target Start/End: Complemental strand, 29773024 - 29772758
Alignment:
| Q |
18 |
ctaatgtatgcagaagtccttctaacataaaattcatctatctcatggccattgtatgttatgctaccagttttctgtaagaataacaaacaaacnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29773024 |
ctaatgtatgcagaagtccttctaacataaaattcatctatctcatggccattgtaggttatgctaccagttttctgtaagaataacaaacaaacaaaaa |
29772925 |
T |
|
| Q |
118 |
nncagtaagaagatgatgggtgagactaacctgtttagtacggaaactttcagattcaagggtgtcccgtgtatgatcacttccactatctcaaatctca |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29772924 |
aacagtaagaagatgatgggtgagacatacctgtttagtacgcaaac-ttcagattcaagggtgtcccgtgtatgatcacttccact-------atctca |
29772833 |
T |
|
| Q |
218 |
aattattacaatgtcacatgtcagtgtcgtgtcccaatgtgcatgcttgatagagagtaacattctatcagatga |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29772832 |
aattattacaatgtcacatgtcagtgtcgtgtcccaatgtgcatgcttgatagagagtaacattctatcagatga |
29772758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University