View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_low_18 (Length: 263)
Name: NF1789_low_18
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 77 - 254
Target Start/End: Complemental strand, 55223223 - 55223045
Alignment:
| Q |
77 |
ccaaaaatgacctctaatggaatgggccacgctttcctttctgctggccaaggtcaatgtggcctgccacccttgaataacggt-nnnnnnnnnngtagt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55223223 |
ccaaaaatgacctctaatggaatgggccacgctttcctttctgctggccaaggtcaatgtggcctgccacccttgaataacggtaaaaaaaaaaagtagt |
55223124 |
T |
 |
| Q |
176 |
agtgggggaaatgattgcaataatgttaagctatgttaatcaaattataaaatccatcaacaaataacttcagtataat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55223123 |
agtgggggaaatgattgcaataatgttaagctatgttaatcaaattataaaatccatcaacaaataacttcagtttaat |
55223045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 55223452 - 55223422
Alignment:
| Q |
1 |
aaaagagtgacccctcttctctttctcagca |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55223452 |
aaaagagtgacccctcttctctttctcagca |
55223422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University