View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1789_low_30 (Length: 240)

Name: NF1789_low_30
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1789_low_30
NF1789_low_30
[»] chr3 (2 HSPs)
chr3 (158-240)||(23307339-23307421)
chr3 (17-69)||(23307198-23307250)
[»] chr8 (2 HSPs)
chr8 (160-240)||(32090335-32090415)
chr8 (160-240)||(32067320-32067400)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 158 - 240
Target Start/End: Original strand, 23307339 - 23307421
Alignment:
158 tattttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23307339 tattttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat 23307421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 23307198 - 23307250
Alignment:
17 accacttacacttttttcatccattacaaacataaatgcaaaatgatacatat 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
23307198 accacttacacttttttcatccattacaaacataaatgcaaaatgatacatat 23307250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 32090335 - 32090415
Alignment:
160 ttttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat 240  Q
    |||||||||||  | ||||||||||||||| ||||| ||| ||| |||||||||||||||| |||||||||| ||||||||    
32090335 ttttgccttctctaagtccctaagttctttttcttccttagccagcttcttcatcctagcaatctcaaggtccttgctcat 32090415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 240
Target Start/End: Original strand, 32067320 - 32067400
Alignment:
160 ttttgccttctgcatgtccctaagttctttatcttctttacccatcttcttcatcctagcagtctcaaggtcattgctcat 240  Q
    |||||||||||  | || |||||||||||| ||||| ||||| | |||||||||||||||| |||||||||| ||||||||    
32067320 ttttgccttctctaggttcctaagttctttttcttccttaccaagcttcttcatcctagcaatctcaaggtccttgctcat 32067400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University