View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_low_35 (Length: 236)
Name: NF1789_low_35
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 55223565 - 55223779
Alignment:
| Q |
1 |
ctataggtggatggacacgtgtttttctctttctcttttaccaggggatcccatgtctcnnnnnnncctcacccccgccttgttacttgttagttgttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
55223565 |
ctataggtggatggacacgtgtttttctctttctcttttaccaggggatcccatgtctcaaaaaaacctcacccccgccttgttacttgttggt------ |
55223658 |
T |
|
| Q |
101 |
tatgtgttcggtttggcgcgagaagaattctttttgg-ggtggcggaaaacttgcataaactaacatatattatgcattgactccag-gaaatattaaca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||| | |||||||| || |||| |||||| |
|
|
| T |
55223659 |
-atgtgttcggtttggcgcgagaagaattctttttggtggtggcggaaaacttgcatatactaaaatatattacgtattgactctagaaaaatgttaaca |
55223757 |
T |
|
| Q |
199 |
agtgtttttgagatatttttta |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55223758 |
agtgtttttgagatatttttta |
55223779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University