View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_low_36 (Length: 236)
Name: NF1789_low_36
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 220
Target Start/End: Complemental strand, 46309701 - 46309487
Alignment:
| Q |
4 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttcgtgtgttgctaatatatattttcttccaagttcatagcactacccca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46309701 |
aaggatttcatttgttgagattgcagaatggtgattgtgttgaaatttacttcgtgt--tgctaatatatattttcttccaagttcatagcactacccca |
46309604 |
T |
|
| Q |
104 |
ctagtggagatgcttttctttccataacaaagacataaagccatttacattctgcaaatctgattccgagacaatcatagtttgtcaactacacgcacac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
46309603 |
ctagtggagatgcttttctttccataacaaagacataaagccatttacattctgcaaatctgattccaagacaatcatagtttgtcaattacacgcacac |
46309504 |
T |
|
| Q |
204 |
acatcataacacataaa |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46309503 |
acatcataacacataaa |
46309487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 46310443 - 46310403
Alignment:
| Q |
1 |
ttaaaggatttcatttgttgagattgcagaatggtgattgt |
41 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
46310443 |
ttaaaggatttcctttgttgagattgcagaatgttgattgt |
46310403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University