View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1789_low_38 (Length: 231)
Name: NF1789_low_38
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1789_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 25172381 - 25172217
Alignment:
| Q |
18 |
agaatgagcacaacaaaacactgacagcatctgttaggaaccggcatcagcaatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25172381 |
agaatgagcacaacaaaacactgacagcatctgttaggaaccggcatcagcaatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggt |
25172282 |
T |
 |
| Q |
118 |
aagttgtagtagtattatacatacactatcattgatgtgttttcagttcgctggcataacaatttggc |
185 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25172281 |
aagttgt---agtattatacatacactatcattgatgtgttttcagttcgctggcataaaaatttggc |
25172217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University