View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1789_low_44 (Length: 208)

Name: NF1789_low_44
Description: NF1789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1789_low_44
NF1789_low_44
[»] chr8 (2 HSPs)
chr8 (88-199)||(12804935-12805046)
chr8 (1-64)||(12804828-12804889)
[»] chr1 (1 HSPs)
chr1 (129-196)||(36671661-36671728)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 88 - 199
Target Start/End: Original strand, 12804935 - 12805046
Alignment:
88 gactggctgtcatttattgattcgacaatgaaggatgacttagttgactcaccaataaggttgtgggttcaactcccgctataaatgtgaggatctcttt 187  Q
    |||| ||||||||||||| ||||||||||||| | |||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||    
12804935 gactcgctgtcatttattaattcgacaatgaaagttgacttagttgactcaccaacaagatcgtgggttcaactcccgctataaatgtgaggatctcttt 12805034  T
188 ggtggatgatgt 199  Q
     |||||||||||    
12805035 agtggatgatgt 12805046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 12804828 - 12804889
Alignment:
1 taaaatacatgttagatcaggagaaaaagagagatattaaggtgatttataatcacaagagttt 64  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||| ||||||||||||||||    
12804828 taaaatacatgttagatcaggagaaa--gagagatattaaggtgattcataatcacaagagttt 12804889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 196
Target Start/End: Complemental strand, 36671728 - 36671661
Alignment:
129 agttgactcaccaataaggttgtgggttcaactcccgctataaatgtgaggatctctttggtggatga 196  Q
    |||||||||||| | ||||| |||||||||||||||||| | |||||||| | ||||||| |||||||    
36671728 agttgactcacccacaaggtagtgggttcaactcccgctgtcaatgtgagaacctctttgatggatga 36671661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University