View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17900_high_3 (Length: 292)
Name: NF17900_high_3
Description: NF17900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17900_high_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 44474119 - 44473845
Alignment:
| Q |
19 |
ttttggttgctttgggaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgtaattttatga |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474119 |
ttttggttgctttgagaaatgtaaaataacccgagggagtactatttatcaagtataataaaattttgttattattctaagtcgttgtgtaattttatga |
44474020 |
T |
 |
| Q |
119 |
gaattgatcggttgannnnnnnnnnnnnnn-gggtggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttttctttatgcc |
217 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474019 |
gaattgatcggttgattttttttttttttttggggggttccttggaatgtctatggtttcgaggttgcttgtttattttagtaacagttttctttatgcc |
44473920 |
T |
 |
| Q |
218 |
actggatggctacaatgtggcagtctttgaaattggtgatgagtccggtgacttttgaagagtctccgtaatgtt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44473919 |
actggatggctacaatgtggcagtctttgaaattggtgatgagtccggtgacttttgaagagtctccgtaatgtt |
44473845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University