View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_20 (Length: 342)
Name: NF17901_high_20
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 78 - 328
Target Start/End: Complemental strand, 3807418 - 3807166
Alignment:
| Q |
78 |
accagattggtgctataaaccagaaaaaa-taaatgcaacaagttgaaaccaaagtggatacaggattatgatgc-gacatatgtgcttgttggtgccgt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3807418 |
accagattggtgctataaaccagaaaaaaataaatgcaacaagttgaaaccaaagtggatacaggattatgatgctgacatatgtgcttgttggtgccgt |
3807319 |
T |
 |
| Q |
176 |
gctgaatcggactaaaacacggcgagctaccgtgaaactacactttttagattcaacaaaatcaaggtgtgaccgtgattttgtctaatccaccgtgatt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807318 |
gctgaatcggactaaaacacggcgagctaccgtgaaactacactttttagattcaacaaaatcaaggtgtgaccgtgattttgtctaatccaccgtgatt |
3807219 |
T |
 |
| Q |
276 |
taaaacattttcaaaattctaactttagtttattgctgaaccattttcattgt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807218 |
taaaacattttcaaaattctaactttagtttattgctgaaccattttcattgt |
3807166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 34404191 - 34404130
Alignment:
| Q |
213 |
ctacactttttagattcaacaaaatcaaggtgtgaccgtgattttgtctaatccaccgtgat |
274 |
Q |
| |
|
|||||||| ||| |||||||||| || ||||| |||||||||||||| |||||||| |||| |
|
|
| T |
34404191 |
ctacacttcgtagcttcaacaaaagcacggtgtcaccgtgattttgtcgaatccaccatgat |
34404130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University