View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_38 (Length: 270)
Name: NF17901_high_38
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 46214679 - 46214437
Alignment:
| Q |
11 |
caaagggtattgttttctaaccgagagcgtggattttcctttatagattgatgctcctgagaattttcttccatttccaaggctaacatctgcaggaaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46214679 |
caaagggtattgttttctaaccgagagcacggattttcctttatagattgatgctcctgagaattttcttccatttccaaggctaacatctgcaggaaaa |
46214580 |
T |
 |
| Q |
111 |
tctctatccattgtgctagctccaaccgtggtgatccatggcgaaacatttgtgagactgacagggtcaggtcctgaatttccagctgaacatgaaacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46214579 |
tctctatccattgtgctagctccaaccgtggtgatccatggcgaaacatttgtgagactgacagggtcgggtcctgaatttccagctgaacatgaaacaa |
46214480 |
T |
 |
| Q |
211 |
aaacacccttttccattgctccaaatgaagctacagataaact |
253 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46214479 |
aaacacccctttccattgctccaaatgaagctacagataaact |
46214437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 28526280 - 28526232
Alignment:
| Q |
195 |
gctgaacatgaaacaaaaacacccttttccattgctccaaatgaagcta |
243 |
Q |
| |
|
||||| || |||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
28526280 |
gctgagcaagaaacaaaaacaccgtttttcgttgctccaaatgaagcta |
28526232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University