View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_40 (Length: 268)
Name: NF17901_high_40
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 31556487 - 31556235
Alignment:
| Q |
1 |
ccaacatctatttgcaagaaaatgtgaaaaatgtttgtatttataatcaaaattcaagtgaaggttacatgtgaaaaatgtttggatttagaatcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556487 |
ccaacatctatttgcaagaaaatgtgaaaaatgtttgtatttataatcaaaattcaagtgaaggttacatgtgaaaaatgtttggatttagaatcaaaat |
31556388 |
T |
 |
| Q |
101 |
tcaggcgaagaaggttccttggtcaaagaagcataccgtgtgatcaatttagtgccttagaaggtacccttgtttcacgatgattgcttatcaacatggg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556387 |
tcaggcgaagaaggttcctcggtcaaagaagcataccgtgtgatcaatttagtgccttagaaggtacccttgtttcacgatgattgcttatcaacatggg |
31556288 |
T |
 |
| Q |
201 |
acgatatac---tcagacgtagttttactcaattggagaataattcatgtgct |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556287 |
acgatatactgatcagacgtagttttactcaattggagaataattcatgtgct |
31556235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University