View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_53 (Length: 236)
Name: NF17901_high_53
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 7802658 - 7802430
Alignment:
| Q |
1 |
tgtgaaaacttaaaacgacgtcgttttcaaaataatccaaattgggaacacgtgcatgtcacgtgtcatnnnnnnnnnn-catgaaaagagtgaagcttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7802658 |
tgtgaaaacttaaaacgacgtcgttttcaaaataatcaaaattggtaacacgtgcatgtcacgtgtcataaaaaaaaaaacatgaaaagagtgaagcttt |
7802559 |
T |
 |
| Q |
100 |
ctcaccataatcaattttttcagagcttagtacctttctgggctaaagtaattttgttttgtcaggtactataatcaannnnnnngtcaatttatttgtg |
199 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7802558 |
ctcaccataataaattttttctgagcttagtacctttctgggctaaagtaattttgttttgtcaggtactataatcaatttttttgttaatttatttgtg |
7802459 |
T |
 |
| Q |
200 |
ccctttattcaaatgttgtgttggtgtgc |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7802458 |
ccctttattcaaatgttgtgttggtgtgc |
7802430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University