View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_56 (Length: 227)
Name: NF17901_high_56
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 31787285 - 31787067
Alignment:
| Q |
1 |
aattcctggtactgatcaaaatcaatatactcatgggactgggacagggacaggaacaggatatggaacaactggtattggt---------------cat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
31787285 |
aattcctggtactgatcaaaatcaatatactcatgggacagggacaggaacaggaacaggatatggaacaactggttatggtgctagtggtgtaggtcat |
31787186 |
T |
 |
| Q |
86 |
caacaacatggaggagataatagaggggttatggacaagattaaggagaagattcctggtactgaacaaaatacttatgggacaggcactggaacaggtc |
185 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31787185 |
caacaacatggag------agaaaggggttatggacaagattaaggagaagattcctggtactgaacaaaatacttatgggacaggcactggaacaggtc |
31787092 |
T |
 |
| Q |
186 |
atggaacaactggctatggaagcac |
210 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31787091 |
atggaacaactggctatggaagcac |
31787067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 47 - 157
Target Start/End: Complemental strand, 31787374 - 31787264
Alignment:
| Q |
47 |
gggacaggaacaggatatggaacaactggtattggtcatcaacaacatggaggagataatagaggggttatggacaagattaaggagaagattcctggta |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31787374 |
gggacaggaacaggatatggaacaactggtattggtcatcaacaacatggaggagataacagaggggttatggacaagattaaggagaaaattcctggta |
31787275 |
T |
 |
| Q |
147 |
ctgaacaaaat |
157 |
Q |
| |
|
|||| |||||| |
|
|
| T |
31787274 |
ctgatcaaaat |
31787264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 101 - 157
Target Start/End: Complemental strand, 31787443 - 31787387
Alignment:
| Q |
101 |
gataatagaggggttatggacaagattaaggagaagattcctggtactgaacaaaat |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
31787443 |
gataatagaggggtaatggacaagattaaggagaaaattcctggtactgatcaaaat |
31787387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 31787070 - 31787037
Alignment:
| Q |
171 |
gcactggaacaggtcatggaacaactggctatgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31787070 |
gcactggaacaggtcatggaacaactggctatgg |
31787037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University