View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_60 (Length: 213)
Name: NF17901_high_60
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 9 - 195
Target Start/End: Complemental strand, 35603003 - 35602826
Alignment:
| Q |
9 |
ggtagataattctcagtgttaacattttctctgatatgctttttgatttgcttgataggttatcatcccaacaacaaccattgactgtgatgatttcatg |
108 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35603003 |
ggtagctacttctcagtgttaacattttctctgatatgctttttgatttgcttgataggttatcatcccaaccacaaccattgactgtgatgatttcatg |
35602904 |
T |
|
| Q |
109 |
gagtttgtggaagagtcgaaacactaagttgtgagaagcctataacaccactcccatgtccattgtcacttgagcaatggattcact |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35602903 |
gagtttgt---------gaaacactaagttgtgagaagcctctaacaccactcccatgtccattgtcacttgagcaatggattcact |
35602826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University