View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_high_61 (Length: 211)
Name: NF17901_high_61
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_high_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 18706894 - 18706719
Alignment:
| Q |
19 |
atagagcctaaataacatggccatgattagcaagcnnnnnnncacactcgttgggttcacaaaaaatatgagaggaaacaacctgaagacatttatgcca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18706894 |
atagagcctaaataacatggccatgattagcaagttttttttcacactcgttgggttcacaaaaaatatgagaggaaacaacctgaagacatttatgcca |
18706795 |
T |
 |
| Q |
119 |
acggtttcgaagacgaattggaacaatgtcaacaaacttgaaaacaattaaggcactagttaagtcactttccaac |
194 |
Q |
| |
|
||| |||| ||||||| |||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||| |
|
|
| T |
18706794 |
acgatttcaaagacgatttggaacaatgtcaacaaacttaaaagcgattaaggcactagttaagtcactttccaac |
18706719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University