View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17901_low_17 (Length: 375)

Name: NF17901_low_17
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17901_low_17
NF17901_low_17
[»] chr2 (2 HSPs)
chr2 (14-250)||(1329433-1329669)
chr2 (300-356)||(1329719-1329775)


Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 1329433 - 1329669
Alignment:
14 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329433 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 1329532  T
114 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329533 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 1329632  T
214 tgaagtcaaggcccttccaccaccagaggaaccagcc 250  Q
    || ||||||||||||||||||||||||||||||||||    
1329633 tgcagtcaaggcccttccaccaccagaggaaccagcc 1329669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 300 - 356
Target Start/End: Original strand, 1329719 - 1329775
Alignment:
300 ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaag 356  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1329719 ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaag 1329775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University