View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_28 (Length: 311)
Name: NF17901_low_28
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_28 |
 | |
|
| [»] scaffold0176 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 300
Target Start/End: Complemental strand, 38726738 - 38726454
Alignment:
| Q |
16 |
catattccagacacattgtttggagtattttatgaggagattaaccatgctggagctgggggattatgggcagaacttgtgaaaaataaaggcttcgaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38726738 |
catattccagacacattgtttggagtattttatgaggagattaaccatgctggagctgggggattatgggcagaacttgtgaaaaataaaggtttcgaag |
38726639 |
T |
|
| Q |
116 |
caggattccgtggccttaatgattcacaaagaatagatccatggacaattattggagatcagaataaatcttccattactgtatcaactgatatgtcctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38726638 |
caggattccgtggccttaatgattcacaaagaatagatccatggacaattattggagatcagaataaatcttccattactgtatcaactgatatgtcctc |
38726539 |
T |
|
| Q |
216 |
tagttttgagcgtaataaagttgcgttacgcatggatattctttgtcaaggaaaatcttgtccgcgtagcggtgttggcatctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38726538 |
tagttttgagcgtaataaagttgcgttacgcatggatattctttgtcaaggaaaatcttgtccgcgtagcggtgttggtatctct |
38726454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 196 - 299
Target Start/End: Original strand, 34208874 - 34208977
Alignment:
| Q |
196 |
gtatcaactgatatgtcctctagttttgagcgtaataaagttgcgttacgcatggatattctttgtcaaggaaaatcttgtccgcgtagcggtgttggca |
295 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||| ||||| ||||| | ||| |||||||||||||| |||| ||||| | | | |||||||| | |
|
|
| T |
34208874 |
gtatcaactgatcgttcctcttgttttgagcgtaataaggttgctttacgtttagatgttctttgtcaaggacaatcatgtccacttggtggtgttggta |
34208973 |
T |
|
| Q |
296 |
tctc |
299 |
Q |
| |
|
|||| |
|
|
| T |
34208974 |
tctc |
34208977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 96
Target Start/End: Complemental strand, 34155645 - 34155599
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtg |
96 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34155645 |
aggaaattaatcatgcaggagctgggggattgtgggcagaacttgtg |
34155599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 34168260 - 34168306
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtg |
96 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34168260 |
aggaaattaatcatgcaggagctgggggattgtgggcagaacttgtg |
34168306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 34208469 - 34208515
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtg |
96 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34208469 |
aggaaattaatcatgcaggagctgggggattgtgggcagaacttgtg |
34208515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 34446511 - 34446559
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtgaa |
98 |
Q |
| |
|
||||||| || |||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
34446511 |
aggagatcaatcatgctggagctggtggattatggtctgaacttgtgaa |
34446559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 28582 - 28628
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtg |
96 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
28582 |
aggaaattaatcatgcaggagctgggggattgtgggcagaacttgtg |
28628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 96
Target Start/End: Original strand, 35083 - 35129
Alignment:
| Q |
50 |
aggagattaaccatgctggagctgggggattatgggcagaacttgtg |
96 |
Q |
| |
|
|||| ||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35083 |
aggaaattaatcatgcaggagctgggggattgtgggcagaacttgtg |
35129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University