View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_29 (Length: 309)
Name: NF17901_low_29
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 117 - 304
Target Start/End: Original strand, 22492616 - 22492803
Alignment:
| Q |
117 |
taagatcaacaaaccacgacttgacagtactaacttagttggtgtctttttactttttctccctgtctcatttt-ttgcttcgtggtaaatataattaac |
215 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22492616 |
taagatcaacaagccacgacttgactgtactaacttagttggtgtctttttactttttctccctgtctcatttttttgcttcgtggtaaatataattaac |
22492715 |
T |
 |
| Q |
216 |
ttgtgttttttatcgccttatttgatgtctttatagattttatttgggttgttgaatgcattccattatgagtgtgtttgtgatgatgt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22492716 |
ttgtgttttttatcgccttatttgatgtctttatagatttta-ttgggttgttgaatgcattccattttgagtgtgtttgtgatgatgt |
22492803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University