View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_34 (Length: 281)
Name: NF17901_low_34
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 36897169 - 36896903
Alignment:
| Q |
1 |
ctactattctcacacttcacttatctctcaccaatgagcacaatctagcaaccaccaccaaaccttacacaccaatggattcaggaggcaactcttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36897169 |
ctactattctcacacttcacttatctctcaccaatgagcacaatctagcaaccaccaccaaaccttacacaccaatggattcaggaggcaactcttcttc |
36897070 |
T |
 |
| Q |
101 |
agaagagtcctcacttaatggcttgaaatttggccaacgaatctatttcgaagatacagctcttannnnnnnnnnnnnnnnnnnnnnnagtactaccatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36897069 |
agaagagtcctcacttaatggcttgaaatttggccaacgaatctatttcgaagatacagctcttactgctgcttctgctgctgctgctagtactaccatt |
36896970 |
T |
 |
| Q |
201 |
gctgctggttctccttcttcttctggttcaaagaaaggaagaggtgggtcagttcaacattctcaac |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36896969 |
gctgctggttctccttcttcttctggttcaaagaaaggaagaggtgggtcagttcaacattctcaac |
36896903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University