View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17901_low_38 (Length: 274)

Name: NF17901_low_38
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17901_low_38
NF17901_low_38
[»] chr6 (1 HSPs)
chr6 (10-258)||(3856150-3856383)
[»] chr3 (1 HSPs)
chr3 (10-75)||(46471350-46471415)
[»] chr5 (1 HSPs)
chr5 (25-69)||(33446133-33446177)
[»] chr2 (1 HSPs)
chr2 (104-150)||(43377706-43377752)


Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 3856383 - 3856150
Alignment:
10 gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataattattattttttctaannnnnnnnnatgtgtgtg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||         |||||||||    
3856383 gcagagaccagatgcttgatcaacgttgcgaagcaacatgacatgaactccaaccttcaaacataattattattttttctaatttttttt-atgtgtgtg 3856285  T
110 actaaatagagtgaccaaatacttgtgtccattcaagaattgctccttttcaaaagcccnnnnnnnnactttcaaaatcaacgaagaaggaggatcagct 209  Q
    ||             ||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||    
3856284 ac-------------caaatacttgtgtccattcaagaattgctccttttcaaaagcccttttttt-actttcaaaatcaacgaagaaggaggatcagct 3856199  T
210 catggtttcttaaactatactccgtcctatgagttcttgcctctctttg 258  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||    
3856198 catggtttcttaaactatactccgttctatgagttcttgcctctctttg 3856150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 46471415 - 46471350
Alignment:
10 gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46471415 gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa 46471350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 25 - 69
Target Start/End: Complemental strand, 33446177 - 33446133
Alignment:
25 ttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaa 69  Q
    |||||||||||||||||||||||| |||||||| |||||||||||    
33446177 ttgatcaacgttgcgaagcaacataacaggaacaccaaccttcaa 33446133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 43377706 - 43377752
Alignment:
104 tgtgtgactaaatagagtgaccaaatacttgtgtccattcaagaatt 150  Q
    ||||||||||||||||| | |||||| ||||||||||| ||||||||    
43377706 tgtgtgactaaatagagggtccaaattcttgtgtccatccaagaatt 43377752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University