View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_42 (Length: 268)
Name: NF17901_low_42
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 20049948 - 20050201
Alignment:
| Q |
1 |
taggtgcacttgatattaatgcaatgcacatttcgcttatcattttctgtaattaaaattctttagtagaacatattgtggctgatatgtacgtctttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20049948 |
taggtgcacttgatattaatgcaatgcacatttcgcttatcattttctgtaattaaaattctttagtagaacatattgtggctgatatgtacgtctttac |
20050047 |
T |
|
| Q |
101 |
ttcatatgtttatgacgtttaatattacatttatttggcaaagagcaactgcgtggttgattgcagtctaccttccttttcacaaatccctcattttgaa |
200 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20050048 |
ttcatacatttatgacatttaatattacatttatttggcaaagagcaactgcgtggttgattgcagtctaccttccttttcacaaatccctcattttgaa |
20050147 |
T |
|
| Q |
201 |
catcaaatgctcgatcgattatgtgacgacttgacctttgactcgttcgcatttcat |
257 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20050148 |
catcaaatgctcgatcgattatgt---gacttgacctttgactcgttcgcatttcat |
20050201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 20104581 - 20104665
Alignment:
| Q |
8 |
acttgatattaatgcaatgcacatttcgcttatcattttctgtaattaaaattctttagtagaacata-ttgtggctgatatgta |
91 |
Q |
| |
|
|||||||||| ||||||||||| | | |||| |||||| ||||||||| | ||| ||||| ||||| |||||||||||||||| |
|
|
| T |
20104581 |
acttgatatttatgcaatgcacgtcttacttagcatttttcgtaattaaattgcttgagtaggacatatttgtggctgatatgta |
20104665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University