View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_44 (Length: 266)
Name: NF17901_low_44
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_44 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 85 - 266
Target Start/End: Original strand, 14447109 - 14447293
Alignment:
| Q |
85 |
gcctaaactcta--aaaatttcaggctccaccacgttggaattcaaaatttatcacattttcaggtttaaagggtatgaatctatcagttgactatccg- |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14447109 |
gcctaaactctataaaaatttcaggctccaccacgttggaattcaaaatttatcacattttcaggtttaaagggtatgaatctatcagttgactatccga |
14447208 |
T |
 |
| Q |
182 |
gnnnnnnnnnncatatttacaacaaaaatgtaaattcttcgtatccttgtaatatattgtgtcattttcatgataaagggtcttc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14447209 |
aaaaaaaaaaacatatttacaacaaaaatgtaaattcttcgtatccttataatatattgtgtcattttcatgataaagggtcttc |
14447293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University