View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_45 (Length: 263)
Name: NF17901_low_45
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 259
Target Start/End: Complemental strand, 10416792 - 10416549
Alignment:
| Q |
16 |
ttatcaattaaattacaatatgtctcataacacaaatcttactaatacgtttataaacacacaaacataattaattgaaatacagaaatgaaggcatact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416792 |
ttatcaattaaattacaatatgtctcataacacaaatcttactaatacgtttataaacacacaaacataattaattgaaatacagaaatgaaggcatact |
10416693 |
T |
 |
| Q |
116 |
tagcatccctcattttcacaatttgttttgttgcttcagcaaaccttggaagttcacaagtgaatggaagttcttcttcacaaggagatggaagtagttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10416692 |
tagcatccctcattttcacaatttgttttgttgcttcagcaaaccttggaagttcacaagtgaatggaagttcttcttcacaaggagatggaagtagttc |
10416593 |
T |
 |
| Q |
216 |
acaaggtgactcatgtgacaccaagctaaacctctgtgctcctc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
10416592 |
acaaggtgactcatgtgacaccaagctaaacctcagtgttcctc |
10416549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University