View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_46 (Length: 251)
Name: NF17901_low_46
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 37169244 - 37169008
Alignment:
| Q |
1 |
atagggattgtctataatgactgaaacgcctctgtaaaaaggtttagtaagtcaactattcaacggtcaatcctgctagtaatttttcatgcatctgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37169244 |
atagggattgtctataatgactgaaacgcctctgtaaaaaggtttagtaagtcaactattcaacggtcaatcctgctagtaattttttatgcatctgcta |
37169145 |
T |
 |
| Q |
101 |
gtgtttattaatggccaaacaaagaagattgtgtaa---ggttgatcaagttagctttgctttatccttgacgacatgtttactttgaggattgttgaaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37169144 |
gtgtttattaatggccaaacaaagaagattgtgtaaggtggttgatcaagttagctttgctttatccttgacgacatgtttactttgaggattgttggaa |
37169045 |
T |
 |
| Q |
198 |
gnnnnnnntggagaagcataaagttaggatcaataata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37169044 |
-aaaaaaaaggagaagcataaagttaggatcaataata |
37169008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University