View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17901_low_49 (Length: 247)

Name: NF17901_low_49
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17901_low_49
NF17901_low_49
[»] chr3 (1 HSPs)
chr3 (1-237)||(49410155-49410387)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 49410387 - 49410155
Alignment:
1 atagaccaagatatggtgatgatgatgatgataacggtggatggagacggcgtgatccgtttttgtttgcaaggaaattttcagctgagtgtttacaact 100  Q
    |||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49410387 atagaccaagatatggtgatgatgatgat---aacggtggatggagacggcgtgatccgtttttgtttgcaaggaaattttcagctgagtgtttacaact 49410291  T
101 gttgacggagatagctgatggcgtgatatttaaggactagagagtagcaatctcaatggcggctttctagtgttttaggttggagaaccattggagaggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49410290 gttgacggagatagctgatggcgtgatatttaaggactagagagtagcaatctcaatggcggctttctagtgttttaggttggagaaccattggagaggt 49410191  T
201 ttggcaataatactaaaaagggaattagactcctatg 237  Q
    ||||||||||| |||||||||||||||||| ||||||    
49410190 ttggcaataat-ctaaaaagggaattagacccctatg 49410155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University