View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_51 (Length: 244)
Name: NF17901_low_51
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_51 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 138
Target Start/End: Complemental strand, 32605630 - 32605508
Alignment:
| Q |
16 |
atcacttgataatcttgtaaaaaacatagcacaaacacatagttgtctagttttggtcatttgacatggttcaaggtcttgctggaatgactctaaaatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32605630 |
atcacttgataatcttgtaaaaaacatagcagaaacacatagttgtctagttttggtcatttgacatggttcaaggtcttgctggaatgactctaaaatg |
32605531 |
T |
 |
| Q |
116 |
actcataaacaccaataaaaaca |
138 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32605530 |
actcataaacaccaataaaaaca |
32605508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 5849729 - 5849662
Alignment:
| Q |
176 |
atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagctt |
244 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5849729 |
atgcatttcttaaccaac-ccatgactcagcacatggtgactcatagcagagatattatctagaagctt |
5849662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 5843693 - 5843626
Alignment:
| Q |
176 |
atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagctt |
244 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5843693 |
atgcatttcttaaccagc-ccatgactcagcacatggtgactcatagcagagatattatctagaagctt |
5843626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 6090203 - 6090134
Alignment:
| Q |
21 |
ttgataatcttgtaaaaaacatagcacaaacacatagttgtctagttttggtcatttgacatggttcaag |
90 |
Q |
| |
|
|||||||||| ||||||| ||||||||| || ||||||||||||||| ||| | |||||||| |||||| |
|
|
| T |
6090203 |
ttgataatctcgtaaaaagtatagcacaaccatatagttgtctagtttaggtgaattgacatgtttcaag |
6090134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University