View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_52 (Length: 244)
Name: NF17901_low_52
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_52 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 244
Target Start/End: Original strand, 7471093 - 7471333
Alignment:
| Q |
4 |
acaccattccatgacttggttgaaaagaaaccaaaacaaaagagtaagatgaagcatttattttcctattttcttggttgcattgccttttgatagggca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7471093 |
acaccattccatgacttggttgaaaagaaaccaaaacaaaagagtaagatgaagcatttattttcctattttcttggttgcattgccttttgatagggca |
7471192 |
T |
|
| Q |
104 |
ctccagaattctgcatacatcaagtatggattgttggattagctttcaaaggattcatctaaggatttggcattgttggttgatgaatttaatttttatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7471193 |
ttccagaattctgcatacatcaagtatggattgttggattagctttcaaaggatccatctaaggatttggcattgttggttgatgagtttaatttttatt |
7471292 |
T |
|
| Q |
204 |
ttcttttgtcattgatgcaagaatatcagaactcaagttta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7471293 |
ttcttttgtcattgatgcaagaatatcagaactcaagttta |
7471333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University