View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17901_low_58 (Length: 230)
Name: NF17901_low_58
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17901_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 4670477 - 4670258
Alignment:
| Q |
8 |
gcagaacctgtgcacaatagattggacaccaactgcactactatagaaaacattgtgatggtatcgttaatagtataagttgttgttggaataaaggtga |
107 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4670477 |
gcagaacctatacacaatagattggacaccaactgcactactatagaaaacattgtgatggtatcgtttatagtataagttgttgttggaataaaggtga |
4670378 |
T |
 |
| Q |
108 |
gttttttgatgaaattgagag--------------aaaaaggatgagattagagagattatgtgattgagagtaatggaaagtgcttttgcttttcaata |
193 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4670377 |
gttttttgatgaaattgagagaaaagagtagagagaaaaaggatgagattagagagattatgtgattgagagtaatggaaagtgcttttgcttttcaata |
4670278 |
T |
 |
| Q |
194 |
tatgatttcaattacaattg |
213 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4670277 |
tatgatttcaattacaattg |
4670258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 195
Target Start/End: Complemental strand, 36360438 - 36360367
Alignment:
| Q |
124 |
gagagaaaaaggatgagattagagagattatgtgattgagagtaatggaaagtgcttttgcttttcaatata |
195 |
Q |
| |
|
||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
36360438 |
gagagaaaagggatgggattagaaagattatgtgattgagagtaatggaaagtgtttttgattctcaatata |
36360367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University