View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17902_high_2 (Length: 528)
Name: NF17902_high_2
Description: NF17902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17902_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 479 - 518
Target Start/End: Original strand, 1193790 - 1193829
Alignment:
| Q |
479 |
tagtaatctaagaaatcttgcattatcctgtttctattgt |
518 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1193790 |
tagtaatctaagaaatcttgcattatcctgtttcttttgt |
1193829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 96 - 138
Target Start/End: Complemental strand, 45635141 - 45635099
Alignment:
| Q |
96 |
gcttctttttaaccatcaacatggcactgccaactcttgcaac |
138 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
45635141 |
gcttctttttagcaatcaacatggcactgccaacccttgcaac |
45635099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University