View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17902_low_17 (Length: 232)
Name: NF17902_low_17
Description: NF17902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17902_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 25523624 - 25523400
Alignment:
| Q |
1 |
cgtgtcatctttgtccttaagccacacatgttgcacgtgtcc-----------------ttcataatttttcataaactggttccatctagattttccca |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25523624 |
cgtgtcatctttgtccttaagccacacatgttgcacgtgtccatcatagttcttagcacttcataatttttcataaactggttccatctagattttccca |
25523525 |
T |
 |
| Q |
84 |
attaaacttgttgtattaattaattgccatgcattagtttactactttccatgcacgttttgcattctataaataaaaccatatatgaaactttcttttt |
183 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25523524 |
attaaaattgttgtattaatt----gccatgcattagtttactactttccatgcacgttttgcattctataaataaaaccatatatgaaactttcttttt |
25523429 |
T |
 |
| Q |
184 |
ctctatcctatcttatcttgtgaacaatc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25523428 |
ctctatcctatcttatcttgtgaacaatc |
25523400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University