View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17902_low_5 (Length: 430)
Name: NF17902_low_5
Description: NF17902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17902_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 19324840 - 19324672
Alignment:
| Q |
1 |
gtaaccatgattggcatgatctatggaataatttagctgatattctcttcccaaaaattttaaagatccccatcctatttttcgtagaagtgataatcca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19324840 |
gtaaccatgattggcttgatctatggaataatttagctgatattctcttcccaaaatttttaatgatccccatcctatttttcgtagaagtgataatcca |
19324741 |
T |
|
| Q |
101 |
tctatctctcatatttcccccatttaaattcttcaa--attaacaactgatgagattttccatcaaatg |
167 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
19324740 |
tctatctctcatattccccccttttaaattcttcaaatatggacaactgatgagattttccatcaaatg |
19324672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 283 - 411
Target Start/End: Complemental strand, 19324459 - 19324331
Alignment:
| Q |
283 |
aaatgcacatcaaagatatatgtgataaagttaagattaaattggctacatggaaaagtgattttctttcaaatatgggaagagttcaacttattaaatc |
382 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19324459 |
aaatgaacttcaaagatatatgtgataaagttaagattaaattggctacatggaaaagtgattttctttcaaatatgggaagagttcaacttattaaatc |
19324360 |
T |
|
| Q |
383 |
aattatgctcgcctattctttcagcatat |
411 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19324359 |
aattatgctcgcctattctttcagcatat |
19324331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University