View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_35 (Length: 364)
Name: NF17903_high_35
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 53721807 - 53721601
Alignment:
| Q |
1 |
ctccacccttagtttccttgatcgatatcatcactaatttgcgaccggaggtggacaaactgtcaacagagttgtgttggcttctctttgtaaaatcttc |
100 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721807 |
ctccacccttagtttacttgatcgatctcatcactaatttgcgaccggaggtggacaaactgtcaacagagttgtgttggcttctctttgtaaaatcttc |
53721708 |
T |
|
| Q |
101 |
ctgatatttttatatatacacatctcaatcaattcattctttttacctcgcatattagctgccatgccaaactcctgtggattactgagagacacgggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721707 |
ctgatatttttatatatacacatctcaatcaattcattctttttacctcgcatattagctgccatgccaaactcctgtggattactgagagacacgggta |
53721608 |
T |
|
| Q |
201 |
tgcatac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
53721607 |
tgcatac |
53721601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 277 - 362
Target Start/End: Complemental strand, 53721530 - 53721445
Alignment:
| Q |
277 |
gcaggaatcaggatcctcatagaatttccttgctaaaaagatggatggtgaaatcagatnnnnnnngtcgctttctgcctatgctt |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
53721530 |
gcaggaatcaggatcctcatagaatttccttgctaaaaagatggatggtgaaatcagataaaaaaagtcgctttctgcctctgctt |
53721445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University