View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_65 (Length: 279)
Name: NF17903_high_65
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_65 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 96 - 279
Target Start/End: Original strand, 40184627 - 40184804
Alignment:
| Q |
96 |
atttagatacacatgtatattttgaagtgttcgtgtgtgtcatgccaagtctccat-tctaagtttgtaaaatcataaggtccctagtattcttaccact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | ||||| |||||||||||||| |
|
|
| T |
40184627 |
atttagatacacatgtatattttgaagtgttcgtgtgtgtcatgccaagtctccatgtctaagtttgtaaa-tcata-gatccctggtattcttaccact |
40184724 |
T |
 |
| Q |
195 |
ggatctggccctgggaaaactggcataacataacattgcctcttagtaaatgaaaacgggaaatcataggtcccaagtgtccata |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40184725 |
ggatctggccctgggaaaactggcataacat-----tgtctcttagtaaatgaacacgggaaatcataggtcccaagtgtccata |
40184804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 40184585 - 40184627
Alignment:
| Q |
1 |
tgattacataattttaaactttcatagtagataggtgaatgta |
43 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40184585 |
tgattacatcattttaaactttcatagtagataggtgaatgta |
40184627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University