View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_69 (Length: 267)
Name: NF17903_high_69
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 32649597 - 32649359
Alignment:
| Q |
11 |
aagaatatcaacataaaatggttggatattatagacgaggggtccataacccataattatgcattttctatgttccaaaatcccccattaagcatgagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32649597 |
aagaatatcaacataaaatggttggatattatagacgaggggtccataacccataattatgcattttctatgttccaaaatcccccattaagcatgagaa |
32649498 |
T |
 |
| Q |
111 |
tgttaggcgatctgctcccacatacaaaaaccacgtgtttcccttagatgtgatgaaccttaagtgacaatttgcacgcttaatttggataattcaattg |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32649497 |
tattaggcgatctgctcccacatacaaaaaccacgtgtttcccttagatgtgatgaaccttaagtgacaatttgcacgcttaatttggataattcaattg |
32649398 |
T |
 |
| Q |
211 |
gtattgcttgatgatcctaatcagacaatatcatctatt |
249 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32649397 |
gtattgcttgatggtcctaatcagacaatatcatctatt |
32649359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University