View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_72 (Length: 261)
Name: NF17903_high_72
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 42185651 - 42185433
Alignment:
| Q |
1 |
acaggtccatggttgacatagtcaaagttagatctatgtgatcttatccaatagacaacaattggatcaggcccacacaagaaataatactattgttttg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
42185651 |
acaggtctatggttgacatagtcaaagttagatctatg--atcttatccaacagacaacaattggatcaggaccacacaacaaataacactattgttttg |
42185554 |
T |
|
| Q |
101 |
gcattcattaattgttagtattagtacactctc------acaggcagagactagagatggagtacaacacaacacaacacagcaaagagtcttattcaca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
42185553 |
gcattcattaattgttagtattagtacactctcacagtcacaggcagagactagagatggagtacaacacgacacaacatagcaaagagtcttattcaca |
42185454 |
T |
|
| Q |
195 |
taaaacagaaacactggttgt |
215 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42185453 |
taaaacagaaacactggttgt |
42185433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University