View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_75 (Length: 252)
Name: NF17903_high_75
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 53722066 - 53721861
Alignment:
| Q |
39 |
aagagggagggaattaatgacacccacctccgtctgtcttatttattcccaaatccccgtcagtcacatcttaaatagagctggctggctgcatatgcct |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53722066 |
aagagggagggaattaatgacacccacctccgtctgtcttatttattcccaaatccccgtcagtcacatcttaaatagagctggctggctgcatatgcct |
53721967 |
T |
|
| Q |
139 |
ttaccctaacacctattcccatggcactagcag---tattaatcgccaaaacctatcaaatctcataatcttcgatcctttcttgatctctcaagtttca |
235 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721966 |
ttaccctaacacctattcctatggcactagcagtaatattaatcgccaaaacctatcaaatctcataatcttcgatcctttcttgatctctcaagtttca |
53721867 |
T |
|
| Q |
236 |
tctcac |
241 |
Q |
| |
|
| |||| |
|
|
| T |
53721866 |
tttcac |
53721861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University