View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17903_high_76 (Length: 251)

Name: NF17903_high_76
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17903_high_76
NF17903_high_76
[»] chr3 (1 HSPs)
chr3 (1-154)||(49517402-49517554)
[»] chr4 (1 HSPs)
chr4 (45-97)||(27746843-27746895)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 49517402 - 49517554
Alignment:
1 ctgactagttgcaaactctctttataacatgcttaagtgtgcgaataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgttacan 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
49517402 ctgactagttgcaaactctctttataacatgcttaagtgtgcgaataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgttaca- 49517500  T
101 nnnnnnnnnnnngagaaattgttacatataaatcgggaagcattcatatactca 154  Q
                ||||||||||||||||||||||||||||||||||||||||||    
49517501 ttttttttttttgagaaattgttacatataaatcgggaagcattcatatactca 49517554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 27746843 - 27746895
Alignment:
45 ataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgtta 97  Q
    |||||||||||||| |||||||| ||| ||||||||||||||||| |||||||    
27746843 ataacttgcagtatcgatgtatcctgtgcatgtgtctattttgttaattgtta 27746895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University