View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_76 (Length: 251)
Name: NF17903_high_76
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 49517402 - 49517554
Alignment:
| Q |
1 |
ctgactagttgcaaactctctttataacatgcttaagtgtgcgaataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgttacan |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49517402 |
ctgactagttgcaaactctctttataacatgcttaagtgtgcgaataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgttaca- |
49517500 |
T |
 |
| Q |
101 |
nnnnnnnnnnnngagaaattgttacatataaatcgggaagcattcatatactca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49517501 |
ttttttttttttgagaaattgttacatataaatcgggaagcattcatatactca |
49517554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 45 - 97
Target Start/End: Original strand, 27746843 - 27746895
Alignment:
| Q |
45 |
ataacttgcagtattgatgtatcttgtacatgtgtctattttgttgattgtta |
97 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||| ||||||| |
|
|
| T |
27746843 |
ataacttgcagtatcgatgtatcctgtgcatgtgtctattttgttaattgtta |
27746895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University