View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17903_high_78 (Length: 250)

Name: NF17903_high_78
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17903_high_78
NF17903_high_78
[»] chr8 (2 HSPs)
chr8 (72-213)||(45011530-45011671)
chr8 (16-71)||(45011696-45011751)
[»] chr5 (1 HSPs)
chr5 (16-71)||(3172310-3172365)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 213
Target Start/End: Complemental strand, 45011671 - 45011530
Alignment:
72 tataaaggatccctcatcaattgagaaacagggatggcatgcctttaagtcggtttatttggacaaacaaaatgtaaagcttgatgtctataggtttaga 171  Q
    |||||||||||||||||||||||| ||||| |||||| | ||||||| ||| || ||||| |||||||||||||||| |||||||||  |||||||||||    
45011671 tataaaggatccctcatcaattgaaaaacaaggatgggaagcctttaggtcagtgtattttgacaaacaaaatgtaaggcttgatgttaataggtttaga 45011572  T
172 ccaacattacatgaagcctttgaattattgtatcaataaggt 213  Q
    |||||||||||  ||||| |||| |||||| |||||||||||    
45011571 ccaacattacagaaagcccttgagttattgcatcaataaggt 45011530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 45011751 - 45011696
Alignment:
16 atgaacataaagtacttggaatataaaataaggtttgaagaaagcactcttataca 71  Q
    ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||    
45011751 atgaacataaaatacttggaatataaaataaggttggatgaaagcactcttataca 45011696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 3172365 - 3172310
Alignment:
16 atgaacataaagtacttggaatataaaataaggtttgaagaaagcactcttataca 71  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
3172365 atgaacataaagtacttggaatataaaataaggttggaagaaagcactcttataca 3172310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University