View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_84 (Length: 240)
Name: NF17903_high_84
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 47192405 - 47192200
Alignment:
| Q |
16 |
atgaaatggccaaaggaatcgagtagcgcgattttagtaacattataagttgatcttcctgcatcaacaggtaatacccaaggtgatggccaatagacac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192405 |
atgaaatggccaaaggaatcgagtagcgcgattttagtaacattataagttgatcttcctgcatcaacaggtaatacccaaggtgatggccaatagacac |
47192306 |
T |
 |
| Q |
116 |
tagataacaaaggacttttgaatagaagacgaagagcattgtcgttgtcgaaataaaacttatagaaacctgaggaatagtttgtttcacttttggatga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47192305 |
tagataacaaaggacttttgaatagaagacgaagagcattgtcgttgtcgaaataaaacttatagaaacctgaggaatagtttgtttcacttttggatga |
47192206 |
T |
 |
| Q |
216 |
aactaa |
221 |
Q |
| |
|
|||||| |
|
|
| T |
47192205 |
aactaa |
47192200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University