View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_87 (Length: 237)
Name: NF17903_high_87
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6221088 - 6221318
Alignment:
| Q |
1 |
atcagactttatttacctcacgtttaccgctgcattactggaatctttttcccctaaat------atcatgatgatgaacaaaccnnnnnnnnnnnnnct |
94 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
6221088 |
atcagactttatttac-tcacgcttagcgctgctttactggaatctttttcccctaaatctaaatatcatgatgatgaacaaaccaaaaaataaaaaact |
6221186 |
T |
 |
| Q |
95 |
tattgcgcatacgccccaccccaaagtaaaagtaacaataatacccaacaaaagggaccagtttctaac----caaggtgctgcttttcaccttttatca |
190 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
6221187 |
tattgcacatacgccccaccccaaagtaaaagtaacaataatacccaacaaaagggaccaatttctaactaattaaggtgctgcttttcaccttttatca |
6221286 |
T |
 |
| Q |
191 |
gtgatcacataaaagtcattatgtttattgtt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6221287 |
gtgatcacataaaagtcattatgtttattgtt |
6221318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University