View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_high_99 (Length: 215)
Name: NF17903_high_99
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_high_99 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 34101570 - 34101388
Alignment:
| Q |
18 |
cccccttccaacgataagcgcgctgaggttgagagtgttgatctctaagcagagacgctccttgatttcatgatccatcacaatatggagattgtgagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34101570 |
cccccttccaacgataagcgcgctgaggttgagactgttgatctctaagcagagacgctccttgatttcatgatccatcacaatgtggagattgtaagga |
34101471 |
T |
|
| Q |
118 |
atctgtgcttgaagtaacggtttcgcaaaatcgttaagtttggaaatcgtgtacacgtggaagtagtttttcatcttcttcat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101470 |
atctgtgcttgaagtaacgatttcgcaaaatcgtcaagtttggaaatcgtgtacacgtggaagtagtttttcatcttcttcat |
34101388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University