View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_100 (Length: 227)
Name: NF17903_low_100
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_100 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 108 - 227
Target Start/End: Original strand, 42723182 - 42723301
Alignment:
| Q |
108 |
atgcaacacaatggaccatccatctgaaatttgtaatagaatttactgacaatatacccatggggaattcaaattactagtcaagtctatttactactct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42723182 |
atgcaacacaatggaccatccatctgaaatttgtaatagaatttactgacaatatacccatgggaaattcaaattactagtcaagtctatttactactct |
42723281 |
T |
 |
| Q |
208 |
tatagtatttgtcttttaaa |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42723282 |
tatagtatttgtcttttaaa |
42723301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 42723070 - 42723136
Alignment:
| Q |
1 |
ataaacaaagttagctagtgtgtcctcattcctccaagtcccaaataactggaagttaccctttatt |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42723070 |
ataaacaaagttagctagtgtgtcctcattcctccaagtcccaaataactggaggttaccctttatt |
42723136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University