View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_103 (Length: 223)
Name: NF17903_low_103
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_103 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 51154338 - 51154218
Alignment:
| Q |
7 |
tgaagaagcataggcgcctaaagaacaattttgaaattacatttacactatactgaaatagaatcgatatctcatactttgatggttattgtttattttc |
106 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51154338 |
tgaagaatcctaggcgcctaaagaacaattttgaaattacatttacactatactgaaatagaatcgatatctcatac-ttgatggttattgtttattttc |
51154240 |
T |
|
| Q |
107 |
ttggtttggattgcttgaataa |
128 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
51154239 |
ttggtttggattgcttggataa |
51154218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University