View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_108 (Length: 206)
Name: NF17903_low_108
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 41830631 - 41830807
Alignment:
| Q |
15 |
cataggcatactcatgtagttgttgtaatttgcatgttgtatagaaatataggacccttgttgtatattgaaatctttgttaggttcaggtgaggactca |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830631 |
cataggcatactcatgtagctgttgtaatttgcatgttgtatagaaatataggacccttgttgtatattgaaatctttgttaggttcaggtgaggactca |
41830730 |
T |
 |
| Q |
115 |
tcacttggatttggtgaggttgaagaagacaagttcttaagtcttttctttatagttgaattccaaaagttttttat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41830731 |
tcacttggatttggtgaggttgaagaagacaagttcttaagtcttttctttatagttgaattccaaaagttttttat |
41830807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 142 - 185
Target Start/End: Original strand, 24358388 - 24358431
Alignment:
| Q |
142 |
gacaagttcttaagtcttttctttatagttgaattccaaaagtt |
185 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24358388 |
gacatgttcttgagtcttttctttattgttgaattccaaaagtt |
24358431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 5948210 - 5948243
Alignment:
| Q |
158 |
ttttctttatagttgaattccaaaagttttttat |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
5948210 |
ttttctttatggttgaattccaaaagttttttat |
5948243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University