View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_45 (Length: 340)
Name: NF17903_low_45
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 42877534 - 42877670
Alignment:
| Q |
19 |
ccggtaatgtatttatgatcacataacaaatcatatatccaaaacaagtggaattttacttttgagaaagagaaatcccatgtgactggagttaaatact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42877534 |
ccggtaatgtatttatgatcacataacaaatcatatatccaaaacaagtggaattttacttttgagaaagagaaatcccatgtgactggagttaaatact |
42877633 |
T |
|
| Q |
119 |
aa-----atattgtaatgcatatgtggtgtcatatat |
150 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
42877634 |
aaataatatattgtaatgcatatgtggtgtcatatat |
42877670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 42877792 - 42877835
Alignment:
| Q |
281 |
tgctgactaagaagcacgggaaacaagtgaaaggagtatgaact |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42877792 |
tgctgactaagaagcacgggaaacaagtgaaaggagtatgaact |
42877835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 243
Target Start/End: Original strand, 42877726 - 42877763
Alignment:
| Q |
206 |
tgttgtgatatatttattttgacgtggtgacaatgtga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42877726 |
tgttgtgatatatttattttgacgtggtgacaatgtga |
42877763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University