View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_55 (Length: 309)
Name: NF17903_low_55
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 143 - 293
Target Start/End: Complemental strand, 4419298 - 4419150
Alignment:
| Q |
143 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattccnnnnnnnnnnnnngtgggatactagttgtaaaaataagatgatgttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4419298 |
ggaatatagctcaaatcttcttaaaagtgccatggtagtgattcgtgaattccttttttttttt--gtgggatactagttataaaaataagatgatgttt |
4419201 |
T |
 |
| Q |
243 |
ttggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419200 |
ttggcatatatggccagggatgacccaaaagaaaaggtcactaaggttctt |
4419150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 75
Target Start/End: Complemental strand, 4419433 - 4419378
Alignment:
| Q |
20 |
tcgaaaacatgcataattatattggatcactacaaagagatacaataatcacacaa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4419433 |
tcgaaaacatgcataattatattggatcactacaaagagatacaataatcacacaa |
4419378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University