View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_65 (Length: 286)
Name: NF17903_low_65
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 2535332 - 2535478
Alignment:
| Q |
18 |
atactgatttgccttgattagataatcatggtaaatttcttgaagccatgagaatgttatatgagcctctagcatgtggctctactcccaagaactcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2535332 |
atactgatttgccttgattagataatcatggtaaatttcttgaagccatgagaatgttatatgagcctctagcatgtggctctactcccaagaactcaat |
2535431 |
T |
|
| Q |
118 |
taaccatatagtcgcatcgtctttcgccatcgggggatatggttaag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2535432 |
taaccatatagtcgcatcgtctttcgccattgggggatatggttaag |
2535478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 161 - 274
Target Start/End: Original strand, 2535627 - 2535740
Alignment:
| Q |
161 |
taagtagtttaccgattaaactgaaagttgttggtctttatttgttacctctatgttaatgttgtgcatatatcgtgattaactggattgtagtttgtgt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2535627 |
taagtagtttaccgattaaactgaaagttgttggtctttatttgttacctctatgttaatgttgtgcatatatcgtgattaacttgattgtagtttgtgt |
2535726 |
T |
|
| Q |
261 |
ttctaaagtagtat |
274 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2535727 |
ttctaaagtagtat |
2535740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University