View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_78 (Length: 254)
Name: NF17903_low_78
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 4939800 - 4939581
Alignment:
| Q |
14 |
ataattctgaggtgagggctaagttgtatattgacttaaataattgatacttgctctcatatataggttcatatggttacgtggccccagagattttaga |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4939800 |
ataattatgaggtgagggctaagttgtatattgacttaaataattgatacttgctctcatatataggttcatatggttacgtggccccagagattttaga |
4939701 |
T |
|
| Q |
114 |
aaacaataaagtaacagataagtgtgacgtttactcctttggtaaaattctactagaagtggtatgcttggagaagttagaaaatgttaagagacagaga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||| || |
|
|
| T |
4939700 |
aaacaataaagtaacagataagtgtgacgtttactcctttggtaatattctactagaagtggtatgcttggaaaagttagaaaatgtt--gagacaaagg |
4939603 |
T |
|
| Q |
214 |
ctcccaatggaggagaatattg |
235 |
Q |
| |
|
||||||| || |||||||||| |
|
|
| T |
4939602 |
ttcccaatagaagagaatattg |
4939581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University