View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17903_low_82 (Length: 250)
Name: NF17903_low_82
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17903_low_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 213
Target Start/End: Complemental strand, 45011671 - 45011530
Alignment:
| Q |
72 |
tataaaggatccctcatcaattgagaaacagggatggcatgcctttaagtcggtttatttggacaaacaaaatgtaaagcttgatgtctataggtttaga |
171 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| | ||||||| ||| || ||||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
45011671 |
tataaaggatccctcatcaattgaaaaacaaggatgggaagcctttaggtcagtgtattttgacaaacaaaatgtaaggcttgatgttaataggtttaga |
45011572 |
T |
 |
| Q |
172 |
ccaacattacatgaagcctttgaattattgtatcaataaggt |
213 |
Q |
| |
|
||||||||||| ||||| |||| |||||| ||||||||||| |
|
|
| T |
45011571 |
ccaacattacagaaagcccttgagttattgcatcaataaggt |
45011530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 45011751 - 45011696
Alignment:
| Q |
16 |
atgaacataaagtacttggaatataaaataaggtttgaagaaagcactcttataca |
71 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
45011751 |
atgaacataaaatacttggaatataaaataaggttggatgaaagcactcttataca |
45011696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 3172365 - 3172310
Alignment:
| Q |
16 |
atgaacataaagtacttggaatataaaataaggtttgaagaaagcactcttataca |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3172365 |
atgaacataaagtacttggaatataaaataaggttggaagaaagcactcttataca |
3172310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University